All UK Exam Boards included

Genes and Polypeptides

This is a legacy topic. View the most up to date content by selecting the exam board in the dropdown to the left.

 

It’s important to distinguish between abstract concepts in biology, and actual physical things. DNA is deoxyribonucleic acid, a real molecule which can be viewed using an electron microscope, and which (were you very, very, very small) you could poke.

 

A gene, on the other hand, is just a location, called a locus (locus means location, all hail Latin!) on a specific strand of DNA, which contains the encoded information used to make a certain polypeptide which has a specific role in the development and function of an organism. This code is determined by the sequence of bases (A, T, C and G) at that location.

 

Think of a DNA strand like a bus garage. All buses look the same, they work the same (just like every adenine base is identical to the next adenine, and every thymine is just like the other thymine), yet every bus has a different number on it. This number is the “gene” – it is just a marker which determines where the bus will end up going once it’s left the bus garage.

 

What a terrible example.

 

OK, try this:

 

ATCGTAGCAATATAGCGGATAGCGATGCTAGCGGCGTATAGGCTAGCTTAGGCATTGCTCGATTAGCGGCCCATAGCT

AGGACATCGATCACACAGCTGGACTAGCTAGCTAGCTACACAGCTGAGACACACAGCTATGCTAGAGCTAGGATCTG

AGATCTCACATTGCTATACAAGGCTAGGACTATAGCTTACAGACAGCAGACGACTGTCTATATATATCGACATGCTAGT

AGCTTAGGCTATTAGCTATACAGACAGAATCGATACGACATATATGCGGCTATTACAGACGACATGACAGACATGACA

GCATTCTCGCGCGTATAGCGGCTATAGGCGCGATACGACTACGAGAGAGATCGGACTAGCGGCTACAGTCGGACAC

 

The above is just a tiny, tiny fraction of the sequence of bases in a DNA strand. Every 10 bases, the strand makes another full coil. Imagine it.

 

As any code, it translates into something. Every 3 consecutive bases may code for an amino acid. So the highlighted section may code for 7 amino acids, because there are 21 bases (21/3=7). These seven amino acids are the building blocks of a certain protein. The precise shape and 3D structure of this protein determines its function, and its function is what eventually makes us living things.

 

If as little as 1 error is made in a gene, for example a thymine replaces an adenine, the whole process may be disturbed to the point where debilitating diseases may result. Any change to the genetic code is a mutation. That sounds negative because, well, it is most of the time. Yet the odd mutations which result in positive effects that enhance survival and reproduction are precisely what evolution works on.

 

AGCGGCTATAGGCGCGATACG – let’s assume this is a base sequence part of a gene responsible for haemoglobin.

AGCGGCTATAGGCGCTATACG – what’s this?! well, the same gene, but mutated. This is called an allele. It is a variant of a gene, the same gene which is responsible for haemoglobin.

 

Because the second allele has a T replacing the G, this may cause abnormal hemoglobin to be produced, which may result in Sickle cell disease. The name comes from the shape of red blood cells in affected people.

 

In eukaryotic organisms such as ourselves, most of the DNA doesn’t code for polypeptides (proteins including enzymes). This is due to:

 

1. Repeats of the same sequences or genes, like AATTACAATTACAATTACAATTACAATTACAATTACAATTAC, and

 

2. Non-coding base sequences called introns.
Non-coding DNA is a bit like dark matter in physics. There’s tons of it, it doesn’t seem to do anything, yet it probably does a lot. Studies have suggested that non-coding DNA may contribute to the structural stability of DNA, provide plenty of error space (perhaps like experimenting ground?), act as a switch for certain genes, or promote the expression of some genes.

Sorry! There are no posts.

Sorry! There are no posts.

Your Reviews

OFF TOPIC : I just want to say that your website is brilliant, thank you!!

Anonymous YouTube

Thank you!! Your site is so helpful!

studyaspect YouTube

Good topic notes and cool videos. I'll definitely recommend it to my students.

Seema Sehgal AQA Examiner and biology teacher on LinkedIn

I got A* in A-level biology (Cambridge), thanks! I love your videos

Sherif Negm Facebook

I’ve struggled so much with feeling overwhelmed with biology revision, and I don’t know where to start. But your website is just what I need! It tells me all the information I need, and the knowledge I need to then build on, and it’s written in a way that soaks straight up into my brain!

Prettyhetty The Student Room